Journal of General Virology

Identification and characterization of a new intron in Borna disease virus

Beatrice Cubitt, Calvin Ly and Juan Carlos de la Torre

The Scripps Research Institute, Department of Neuropharmacology IMM-6, 10550 North Torrey Pines Road, La Jolla, CA 92037, USA

Borna disease virus (BDV) has a non-segmented, negative-strand (NNS) RNA genome. In contrast to all other known NNS RNA animal viruses, BDV replication and transcription occur in the nucleus of infected cells. Moreover, BDV uses RNA splicing for the regulation of its genome expression. Two introns (I and II), both present in two viral primary transcripts of 2.5 and 7.2 kb, have been reported in BDV. Here, evidence is provided of a new BDV intron, intron III, generated by alternative 3´ splice-site choice. Intron III-spliced mRNAs were detected at early times post-infection and found to be present in cells from different types and species. Intron III-spliced mRNAs have coding capability for two new viral proteins with predicted molecular masses of 8.4 and 165 (p165) kDa. p165 is a deleted form of the BDV L polymerase, containing three RGD motifs and a signal peptide signal that could target it into the secretory pathway. These findings underscore the proteomic complexity exhibited by BDV.

Borna disease virus (BDV) is a non-segmented, negative-strand (NNS) RNA virus with a genome organization similar to that of other mononegaviruses (Briese et al., 1994; Cubitt et al., 1994 a). However, on the basis of its unique genetic and biological features, BDV is considered to be the prototypic member of a new virus family, the Bornaviridae, within the order Mononegavirales (de la Torre, 1994; Schneemann et al., 1995). In contrast to all other known NNS RNA animal viruses, BDV replication and transcription occur in the nucleus of infected cells (Briese et al., 1992; Cubitt & de la Torre, 1994). Moreover, BDV has the property, unique among known mononegaviruses, of using RNA splicing for the regulation of its genome expression (Pyper & Clements, 1994; Schneider et al., 1994). Three transcription initiation (GS) and four transcription termination/polyadenylation (GE) signals have been mapped within the BDV genome (Schneemann et al., 1994) (Fig. 1 A). The use of GE5*, also referred to as t6 (Briese et al., 1994), in virus-infected cells has not yet been documented. Two primary transcripts of approximately 2.5 and 7.2 kb initiate at the same GS3, but terminate at GE3 and GE4, respectively, due to transcriptional readthrough of GE3 (de la Torre, 1994; Schneemann et al., 1994, 1995) (Fig. 1 B). These two BDV primary transcripts contain two introns that are differentially spliced to generate a set of mature viral mRNAs that allow for balanced expression of the viral proteins M, G and L (Cubitt et al., 1994 b; Schneider et al., 1994, 1997) (Fig. 1 B). Intron I is located within the M ORF and its splicing enhances G expression. An additional ORF predicted in intron II-spliced mRNA species would result in the virus L polymerase (p190) of 190 kDa. Splicing of intron I is also likely needed to promote translation initiation at the AUG of the p190 (L) ORF (Walker et al., 2000).

Fig. 1. Identification of a new intron (intron III) in the BDV genome. (A) BDV genome organization with positions of GS and GE signals indicated. GE5* corresponds to a putative GE signal also referred to as t6 (Briese et al., 1994). (B) Previously identified unspliced and spliced (introns I and II) BDV transcripts starting at GS3 are shown. The predicted sizes of DNA fragments derived from unspliced and spliced mRNAs obtained after RT–PCR with primers 2384F and 4724R are shown between parentheses on the left. Positions of splicing donor (SD) and acceptor (SA) sites are indicated. (C) Primers were: 2384F (sense) 5´ GCGGAATTCCAACGGAAAATGTCATTTCATG (nt 2384–2405) and BV4724R (antisense) 5´ CGCATTCTTTGAGACATAGCC (nt 4724–4704). These positions are with respect to the He80 genome sequence (GenBank accession no. L27077). (D) RT–PCR analysis of cytoplasmic RNA isolated from uninfected and BDV-infected Vero NK cells. Vero NK cells were clonally derived from the Vero E6 cell line. Cytoplasmic RNA was also isolated from cells transfected with plasmid pCAGSpG/L (described in the text). First-strand cDNA synthesis was initiated by priming RNA with the 3´ RACE AP (Gibco BRL) using Thermoscript RT (Gibco BRL). The corresponding cDNA was amplified by PCR with AmpliTaq Gold and the primers described in (C). The cycling conditions were: 94 °C for 10 min followed by 10 cycles of 94 °C for 1 min, 58 °C for 1 min and 68 °C for 3 min, followed by 25 cycles of 94 °C for 1 min, 58 °C for 1 min and 68 °C for 3.5 min, with a final extension at 68 °C for 10 min. Samples were then stored at 4 °C. Amplicons were obtained with the predicted sizes of 2.5 and 1 kb, corresponding to unspliced and intron II-spliced mRNA species. (E) Characterization of a new intron, intron III, in the BDV genome. The ca. 200 bp PCR product was cloned and sequenced. Similarities between the consensus splice site elements for a typical metazoan intron and the newly identified BDV intron III are shown. Y, Pyrimidine; R, purine; N, any nucleotide. The nearly invariant GU and AG dinucleotides at the intron termini and the A at the branch point are also conserved in BDV intron III. Positions on the BDV genome corresponding to the last (nt 2409) and first (nt 4560) nucleotides of the 5´ and 3´ exon sequences are indicated.

Alternative splicing of mRNA precursors is a versatile mechanism of gene expression regulation that accounts for a considerable proportion of proteomic complexity in higher eukaryotes. Its modulation is achieved through the combinatorial interplay of positive and negative regulatory signals present in the RNA, which are recognized by complexes composed of members of the heterogeneous nuclear ribonucleoprotein (hnRNP) and SR protein families (Chabot, 1996; Lopez, 1998; Smith & Valcárcel, 2000). Alternative splicing has been shown to play an important role in the life cycle of several viruses including influenza virus (Lamb & Horvath, 1991), adenovirus (Kanopka et al., 1998), human immunodeficiency virus (HIV) (Berget, 1995) and bovine papillomavirus type 1 (Barksdale & Baker, 1995).

During the course of studies of the regulation of the synthesis of BDV transcripts initiated at GS3, cytoplasmic RNA (5 µg) isolated from Vero cells uninfected or persistently infected with BDV-He80 was converted into cDNA by priming with the 3´ RACE adapter primer (AP) (Gibco BRL) and using Thermoscript reverse transcriptase (RT) at 50 °C for 1 h under conditions recommended by the supplier. PCR with AmpliTaq Gold (Perkin Elmer ABI) and a combination of primer pairs amplified the corresponding cDNA. Analysis of the RT–PCR products obtained with the primer pair 2384F and 4724R (Fig. 1 C, D) revealed amplicons with sizes of approximately 2.5 and 1 kb that corresponded to the predicted unspliced and intron II-spliced BDV mRNA species (Cubitt et al., 1994 b; Schneider et al., 1994). It should be noted that this combination of primers did not allow us to assess the presence or absence of intron I sequences. RNA from BDV-infected cells also yielded an unexpected amplicon of about 200 bp. Similar results were obtained in cells transfected with plasmid pCAGSpG/L, which contains nt 2236–8819 of the BDV-HE80 genome, spanning from the AUG of the G ORF to the stop codon of the L ORF (Fig. 1 D). To determine the sequence relationship between the PCR products obtained and the BDV genome, we cloned and sequenced the 1 kb and 200 bp PCR products. This analysis verified that the 1 kb amplicon was derived from previously characterized intron II-spliced BDV mRNA species. The 200 bp PCR product lacked the region between nt 2410 and 4559 of the BDV genome (deletion III). Inspection of the BDV sequences (antigenomic polarity) at the boundaries of deletion III revealed the presence of sequence motifs similar to the consensus splice site elements for a typical metazoan intron (Green, 1986). The upstream breaking point corresponded to a previously reported splice donor site (SD2) (Fig. 1 B). Sequences characteristic of 3´ splice sites, namely the branch site region, polypyrimidine tract and AG dinucleotide, preceded the 3´ end of the break point (Fig. 1 E). Therefore, deletion III was considered to be a new intron, intron III, in the BDV genome. Splicing of intron III uses the previously described SD2 and an alternative 3´ splice site (SA3) (Fig. 1 E). Consistent with other reports (Jehle et al., 2000), authentic BDV pre-mRNA was spliced with significantly lower efficiency than cDNA-derived viral pre-mRNA (Fig. 1 D).

Two new ORFs with products of estimated molecular masses of 8.4 (p8.4) and 165 (p165) kDa are predicted in intron III-spliced BDV mRNAs (Fig. 2 A). The stop codon of ORF p8.4 was in close proximity to GE5*, a signal that was thought not to operate in virus-infected cells. It seemed plausible, however, that the use of GE5* could facilitate expression of p8.4. Therefore, we revisited the question of whether GE5* is active in BDV-infected cells. For this purpose, cDNA generated by priming RNA from virus-infected cells with the 3´ RACE AP primer was subjected to PCR with primers 2384F and the universal adapter primer (UAP) (Gibco BRL). The UAP primer is complementary to specific sequences present in the 3´ RACE AP primer. A fragment of about 275 bp was amplified from RNA from infected cells, but not from uninfected controls (not shown). Cloning and sequencing of this PCR product verified the presence at its 3´ end (BDV antigenomic polarity) of GE5*. These findings indicated that GE5* is used in BDV-infected cells. The predicted products of ORFs p8.3 and p165 will contain the signal peptide sequence of BDV G. Hence, p8.3 and p165 proteins could be targetted to the ER and enter the secretory pathway (Doms et al., 1993). Consistent with this hypothesis, plasmid-derived p165 protein tagged with a c-Myc epitope accumulated in the ER/Golgi apparatus (Fig. 2 B). Expression of p8.3 and p165 proteins, and their possible secretion to the extracellular milieu in virus-infected cells, remains to be determined. However, it is worth noting the presence of three RGD motifs in p165, which could provide a secreted p165 protein with the ability to interact with integrin molecules present at the cell surface (Ruoslahti & Pierschbacher, 1987). This, in turn, could trigger cellular signal transduction pathways that might contribute to BDV–cell interactions. These findings suggest that alternative splicing of BDV pre-mRNA may generate a 'variant' L gene product with functions other than those predicted for an RNA-dependent RNA polymerase. A similar situation has been proposed for the cytomegalovirus DNA polymerase accessory protein, ppM44 (Loh et al., 2000).

Fig. 2. (A) ORFs predicted in intron III-spliced mRNAs. The ORFs are designated according to their predicted molecular masses (p190, 190 kDa etc.). The end of each arrow indicates the position of the downstream GE signal closest to the stop codon of the corresponding ORF. (B) p165 protein accumulates in the ER/Golgi apparatus. cDNAs containing p190 and p165 ORFs were tagged at the C terminus with a c-Myc epitope and cloned into the pol II expression vector pCAGGS. Cos-7 cells were transfected and fixed 36 h later and analysed by indirect immunofluorescence with a mouse monoclonal antibody to c-Myc, followed by an FITC-labelled anti-mouse IgG.

Changes in the profile and levels of spliced introns during the life cycles of several viruses, including influenza virus, HIV and adenovirus, have been reported to play important roles in the control of virus gene expression and biology (Barksdale & Baker, 1995; Berget, 1995; Kanopka et al., 1998; Lamb & Horvath, 1991). For this reason, we examined the temporal pattern of intron II- and III-spliced BDV mRNAs during the first 90 h of BDV infection and compared it with the steady-state pattern found in BDV persistently infected cells (Fig. 3 A). Using 5 µg of total RNA from BDV-infected Vero cells, intron II- and III-spliced BDV RNA species were first detected readily at 20 and 48 h post-infection (p.i.), respectively. Thereafter, levels of intron II- and intron III-spliced mRNAs did not appear to change significantly. The apparent increase between 48 and 72 h p.i. in intron III-spliced BDV mRNA species was likely due to the corresponding increase in intracellular levels of BDV RNA. Consistent with this interpretation, higher levels of the BDV N amplicon were also obtained at 72 h p.i. Because of its high level of expression in infected cells, detection of BDV N by RT–PCR was done with 5 ng of RNA from infected cells mixed with 5 µg from uninfected cells. This explains the lack of detection of N at 20 h p.i.

Cell type-specific regulated alternative splicing is an integral element of gene expression programmes involved in important biological processes. Variations in the relative concentrations of general splicing factors and hnRNPs can provide a code to establish cell-specific patterns of both levels and site-choice of splicing of multiple mRNAs, including those associated with infecting agents (Chabot, 1996; Lopez, 1998; Smith & Valcárcel, 2000). Consequently, we examined whether the pattern of intron II- and III-spliced BDV mRNA species differed among cell types. Rat glioblastoma C6 cells (Carbone et al., 1993) and the human oligodendroglia cell line OL (Briese et al., 1992, 1994), both persistently infected with BDV, exhibited a pattern of intron II- and III-spliced BDV mRNAs similar to that observed in infected Vero cells (Fig. 3 B). Changes in the subcellular distribution of hnRNP A1 can modulate alternative splicing regulation (van der Houven van Oordt et al., 2000). Stress signals lead to the activation of kinase cascades that can modulate the subcellular distribution of hnRNP A1 and hence also influence RNA processing (Canman & Kastan, 1996). We used osmotic shock to mimic conditions associated with stress-activated cells and evaluate whether altered signal transduction could influence alternative splice-site selection of BDV mRNAs (Kyriakis & Avruch, 1996). We did not observe significant differences in the splicing pattern of BDV mRNAs isolated from cells exposed to 0.6 M sorbitol for 6 h compared to untreated cells (Fig. 3 C).

Fig. 3. (A) Time-course analysis of the appearance of intron III-spliced mRNA species during the natural course of BDV infection. Vero NK cells were infected with BDV at an m.o.i. of about 1 f.f.u. per cell and RNA was harvested at the times indicated. RT–PCR analysis of BDV intron II- and intron III-spliced mRNAs was carried out as described in the legend to Fig. 1 (see also text). RT–PCR analysis of the synthesis of the BDV N mRNA was done by using BDV-specific primers 259F and 829R, as described previously (Sauder et al., 1996). As a control for RNA quality, cDNAs were also amplified with specific primers to generate a 609 bp glyceraldehyde-3-phosphate dehydrogenase (GAPDH) fragment. RT–PCR analysis of BDV N and GAPDH was done by using 5 ng of cytoplasmic RNA from BDV-infected cells together with 5 µg of RNA from uninfected cells. Sizes of the corresponding PCR products are indicated. (B) Identification of intron II- and III-spliced mRNA species in different cell lines persistently infected with BDV. Cytoplasmic RNA was obtained from C6 and OL cells persistently infected with BDV-He80 (C6BV and OLBV, respectively) and from the corresponding uninfected control cells. RNA was analysed by RT–PCR as described in Fig. 1 to detect intron II- and III-spliced mRNA species. (C) Effect of osmotic shock on the pattern of BDV RNA splicing. Cells were either left untreated or exposed to 0.6 M sorbitol (Sorb) for 6 h. Total RNA was extracted and analysed by RT–PCR as described in Fig. 1.

Our findings provide additional evidence that, among the known mononegaviruses, BDV exhibits unique features with respect to the regulation of its genome expression. Consistent with a previous report (Jehle et al., 2000), we also observed an apparent lower efficiency of splicing in virus-derived BDV mRNAs compared with plasmid-derived BDV mRNAs. In addition, we observed a similar splicing pattern in different cell types from different species that was not altered significantly in response to osmotic shock-mediated stress. These results suggest that BDV might have developed strategies that provide it with some degree of insulation from cellular influences that could have unwanted effects on the regulation of virus RNA processing. The same mechanisms may also prevent BDV-induced disturbances of the regulation of the cellular RNA processing machinery, thus facilitating virus persistence without compromising cell viability. The elucidation of the mechanisms underlying the regulation of RNA splicing during BDV RNA synthesis, as well as the identification and functional characterization of the new BDV polypeptides predicted from intron III-spliced viral mRNAs in BDV-infected cells, are expected to contribute significantly to a better understanding of the biology of BDV.

While this manuscript was under review, Tomonaga et al. (2000) published findings similar to those presented here. In addition, these authors also identified a negative regulatory activity of SA3 splicing in the BDV genome (Tomonaga et al., 2000).

This is publication no. 13544-NP from the Department of Neuropharmacology, The Scripps Research Institute, La Jolla, CA, USA. This work was supported by NIH grants NS32355 and MH57063 to J.C.T. We thank Diana Frye for assistance with preparation of the manuscript.

Barksdale, S. & Baker, C. C. (1995). Differentiation-specific alternative splicing of bovine papillomavirus late mRNAs. Journal of Virology 69, 6553–6556.

Berget, S. M. (1995). Exon recognition in vertebrate splicing. Journal of Biological Chemistry 270, 2411–2414.

Briese, T., de la Torre, J. C., Lewis, A., Ludwig, H. & Lipkin, W. I. (1992). Borna disease virus, a negative-strand RNA virus, transcribes in the nucleus of infected cells. Proceedings of the National Academy of Sciences, USA 89, 11486–11489.

Briese, T., Schneemann, A., Lewis, A. J., Park, Y. S., Kim, S., Ludwig, H. & Lipkin, W. I. (1994). Genomic organization of Borna disease virus. Proceedings of the National Academy of Sciences, USA 91, 4362–4366.

Canman, C. E. & Kastan, M. B. (1996). Signal transduction. Three paths to stress relief. Nature 384, 213–214.

Carbone, K. M., Rubin, S. A., Sierra-Honigmann, A. M. & Lederman, H. M. (1993). Characterization of a glial cell line persistently infected with Borna disease virus (BDV): influence of neurotropic factors on BDV protein and RNA expression. Journal of Virology 67, 1453–1460.

Chabot, B. (1996). Directing alternative splicing: cast and scenarios. Trends in Genetics 12, 472–478.

Cubitt, B. & de la Torre, J. C. (1994). Borna disease virus (BDV), a nonsegmented RNA virus, replicates in the nuclei of infected cells where infectious BDV ribonucleoproteins are present. Journal of Virology 68, 1371–1381.

Cubitt, B., Oldstone, C. & de la Torre, J. C. (1994 a). Sequence and genome organization of Borna disease virus. Journal of Virology 68, 1382–1396.

Cubitt, B., Oldstone, C., Valcarcel, J. & de la Torre, J. C. (1994 b). RNA splicing contributes to the generation of mature mRNAs of Borna disease virus, a non-segmented negative strand RNA virus. Virus Research 34, 69–79.

de la Torre, J. C. (1994). Molecular biology of Borna disease virus: prototype of a new group of animal viruses. Journal of Virology 68, 7669–7675.

Doms, R. W., Lamb, R. A., Rose, J. K. & Helenius, A. (1993). Folding and assembly of viral membrane proteins. Virology 193, 545–562.

Green, M. R. (1986). Pre-mRNA splicing. Annual Review of Genetics 20, 671–708.

Jehle, C., Lipkin, W. I., Staeheli, P., Marion, R. M. & Schwemmle, M. (2000). Authentic Borna disease virus transcripts are spliced less efficiently than cDNA-derived viral RNAs. Journal of General Virology 81, 1947–1954.

Kanopka, A., Muhlemann, O., Petersen-Mahrt, S., Estmer, C., Ohrmalm, C. & Akusjarvi, G. (1998). Regulation of adenovirus alternative RNA splicing by dephosphorylation of SR proteins. Nature 393, 185–187.

Kyriakis, J. M. & Avruch, J. (1996). Sounding the alarm: protein kinase cascades activated by stress and inflammation. Journal of Biological Chemistry 271, 24313–24316.

Lamb, R. A. & Horvath, C. M. (1991). Diversity of coding strategies in influenza viruses. Trends in Genetics 7, 261–266.

Loh, L. C., Locke, D., Melnychuk, R. & Lafertet, S. (2000). The RGD sequence in the cytomegalovirus DNA polymerase accessory protein can mediate cell adhesion. Virology 272, 302–314.

Lopez, A. J. (1998). Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation. Annual Review of Genetics 32, 279–305.

Pyper, J. M. & Clements, J. E. (1994). Partial purification and characterization of Borna disease virions released from infected neuroblastoma cells. Virology 201, 380–382.

Ruoslahti, E. & Pierschbacher, M. D. (1987). New perspectives in cell adhesion: RGD and integrins. Science 238, 491–497.

Sauder, C., Muller, A., Cubitt, B., Mayer, J., Steinmetz, J., Trabert, W., Ziegler, B., Wanke, K., Mueller-Lantzsch, N., de la Torre, J. C. & Grasser, F. A. (1996). Detection of Borna disease virus (BDV) antibodies and BDV RNA in psychiatric patients: evidence for high sequence conservation of human blood-derived BDV RNA. Journal of Virology 70, 7713–7724.

Schneemann, A., Schneider, P. A., Kim, S. & Lipkin, W. I. (1994). Identification of signal sequences that control transcription of Borna disease virus, a nonsegmented, negative-strand RNA virus. Journal of Virology 68, 6514–6522.

Schneemann, A., Schneider, P. A., Lamb, R. A. & Lipkin, W. I. (1995). The remarkable coding strategy of Borna disease virus: a new member of the nonsegmented negative strand RNA viruses. Virology 210, 1–8.

Schneider, P. A., Schneemann, A. & Lipkin, W. I. (1994). RNA splicing in Borna disease virus, a nonsegmented, negative-strand RNA virus. Journal of Virology 68, 5007–5012.

Schneider, P. A., Kim, R. & Lipkin, W. I. (1997). Evidence for translation of the Borna disease virus G protein by leaky ribosomal scanning and ribosomal reinitiation. Journal of Virology 71, 5614–5619.

Smith, C. W. J. & Valcárcel, J. (2000). Alternative pre-mRNA splicing: the logic of combinatorial control. Trends in Biochemical Sciences 25, 381–388.

Tomonaga, K., Kobayashi, T., Lee, B.-J., Watanabe, M., Kamitani, W. & Ikuta, K. (2000). Identification of alternative splicing and negative splicing activity of a nonsegmented negative-strand RNA virus, Borna disease virus. Proceedings of the National Academy of Sciences, USA 97, 12788–12793.

van der Houven van Oordt, W., Diaz-Meco, M. T., Lozano, J., Krainer, A. R., Moscat, J. & Caceres, J. F. (2000). The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modulates alternative splicing regulation. Journal of Cell Biology 149, 307–316.

Walker, M. P., Jordan, I., Briese, T., Fischer, N. & Lipkin, W. I. (2000). Expression and characterization of the Borna disease virus polymerase. Journal of Virology 74, 4425–4428.

JGV Direct table of contents

© 2000 SGM

This article is now available in the March 2001 print issue of JGV (vol. 82, 641–646). The complete issue of the journal may be seen in electronic form on JGV Online.