Journal of General Virology |

Fig. 1. Identification of a new intron (intron III) in the BDV genome. (A) BDV genome organization with positions of GS and GE signals indicated. GE5* corresponds to a putative GE signal also referred to as t6 (Briese et al., 1994). (B) Previously identified unspliced and spliced (introns I and II) BDV transcripts starting at GS3 are shown. The predicted sizes of DNA fragments derived from unspliced and spliced mRNAs obtained after RTPCR with primers 2384F and 4724R are shown between parentheses on the left. Positions of splicing donor (SD) and acceptor (SA) sites are indicated. (C) Primers were: 2384F (sense) 5´ GCGGAATTCCAACGGAAAATGTCATTTCATG (nt 23842405) and BV4724R (antisense) 5´ CGCATTCTTTGAGACATAGCC (nt 47244704). These positions are with respect to the He80 genome sequence (GenBank accession no. L27077). (D) RTPCR analysis of cytoplasmic RNA isolated from uninfected and BDV-infected Vero NK cells. Vero NK cells were clonally derived from the Vero E6 cell line. Cytoplasmic RNA was also isolated from cells transfected with plasmid pCAGSpG/L (described in the text). First-strand cDNA synthesis was initiated by priming RNA with the 3´ RACE AP (Gibco BRL) using Thermoscript RT (Gibco BRL). The corresponding cDNA was amplified by PCR with AmpliTaq Gold and the primers described in (C). The cycling conditions were: 94 °C for 10 min followed by 10 cycles of 94 °C for 1 min, 58 °C for 1 min, followed by 25 cycles of 68 °C for 3 min, 94 °C for 1 min and 58 °C for 1 min, with a final extension at 68 °C for 10 min. Amplicons were obtained with the predicted sizes of 2.5 and 1 kb, corresponding to unspliced and intron II-spliced mRNA species. (E) Characterization of a new intron, intron III, in the BDV genome. The ca. 200 bp PCR product was cloned and sequenced. Similarities between the consensus splice site elements for a typical metazoan intron and the newly identified BDV intron III are shown. Y, Pyrimidine; R, purine; N, any nucleotide. The nearly invariant GU and AG dinucleotides at the intron termini and the A at the branch point are also conserved in BDV intron III. Positions on the BDV genome corresponding to the last (nt 2409) and first (nt 4560) nucleotides of the 5´ and 3´ exon sequences are indicated.
0001-7428 © 2000 SGM