| Journal of General Virology |
| SUMMARY | INTRO | METHODS | RESULTS | DISCUSSION | FOOTNOTES | REFS |
| First posted online 1 August 2001 | FULL-LENGTH ARTICLE |
| Rec 14 March 2001; Acc 11 July 2001 | DOI: 10.1099/vir.0.17734-0 |
Chaysavanh Manichanh,1 Camille Olivier-Aubron,3 Jean-Pierre Lagarde,2 Jean-Thierry Aubin,1 Phillipe Bossi,3 Agnès Gautheret-Dejean,1 Jean-Marie Huraux1 and Henri Agut1
Laboratoire de Virologie, UPRES EA 2387,
CERVI1, Laboratoire de Génétique
Moléculaire, Service de Biochimie Médicale2 and
Service des Maladies Infectieuses et Tropicales3, Groupe
Hospitalier Pitié-Salpêtrière, 83 Bld de
l'Hôpital, 75651 Paris Cedex 13, France
After serial passage in the presence of increasing concentrations of ganciclovir (GCV) in vitro, a human herpesvirus-6 (HHV-6) mutant exhibiting a decreased sensitivity to the drug was isolated. Analysis of drug susceptibility showed that the IC50 of this mutant was 24-, 52- and 3-fold higher than that of the wild-type (wt) IC50 in the case of GCV, cidofovir and foscarnet, respectively. Genotypic analysis showed two single nucleotide changes as compared to the wild-type: an A to G substitution of the U69 protein kinase (PK) gene resulted in an M318V amino acid substitution and the other change, located in the C-terminal part of the U38 gene, resulted in an A961V amino acid substitution within the DNA polymerase. The M318V change was located within the consensus sequence DISPMN of the putative catalytic domain VI of the PK. This change was homologous to the M460V and M460I changes that had been reported previously within the consensus sequence DITPMN of the human cytomegalovirus (HCMV) UL97 PK and associated with the resistance of HCMV to GCV. The M318V change was also detected by PCR in HHV-6-infected PBMCs from an AIDS patient who had been treated with GCV for a long period of time and exhibited a clinically GCV-resistant HCMV infection. These findings provide strong circumstantial evidence that the M318V change of the PK gene is associated with resistance to GCV and raise the question of cross resistance to this drug among different betaherpesviruses.
Introduction |
Human herpesvirus-6 (HHV-6) was isolated initially
from lymphocytes of patients with AIDS and lymphoproliferative disorders
(Salahuddin et al., 1986
). The genome of HHV-6 (U1102 strain) was sequenced
entirely (Gompels et al., 1995
) and compared to that of human cytomegalovirus (HCMV)
(Lawrence et al., 1990
). Sequence analysis indicated an overall sequence similarity of 66
%, which confirmed of the classification of both viruses within the same
Betaherpesvirinae subfamily. Two genetically distinct variants (A
and B) were described and the U1102 strain was classified as HHV-6 variant
A (Ablashi et al., 1991
; Aubin et al., 1992
; Schirmer et al., 1991
). Recently, in the case of the Z29 and HST strains, the
complete genome sequence of HHV-6 variant B has been determined. Comparing
the sequences of HHV-6 variants A (U1102 strain) and B has shown 90 %
nucleotide sequence similarity and 94 % amino acid identity (Dominguez
et al., 1999
; Isegawa et al.,
1999
).
HHV-6 is the causative agent of exanthem subitum in
young children (Yamanishi et al., 1988). Because of its tropism for
T lymphocytes, HHV-6 is thought to act as a co-factor of human
immunodeficiency virus (HIV) in AIDS progression, but this hypothesis is
still being debated (Ablashi et al., 1998
; Garzino-Demo et al., 1996
; Lusso & Gallo, 1995
). HHV-6 has been also linked to several other diseases,
such as multiple sclerosis, chronic fatigue syndrome and tumours (Ablashi
et al., 2000
; Berti et al.,
2000
; Ongradi et al., 1999
), but all of these results remain controversial
(Dorrucci et al., 1999
; Taus et al., 2000
). There are now convincing studies that indicate that
HHV-6 behaves as an opportunistic pathogen in liver, renal and bone marrow
transplant recipients (Humar et al., 2000
; Ratnamohan et al., 1998
; Rogers et al., 2000
). Now, the precise frequency of such HHV-6-induced
diseases has to be evaluated. Although the spectrum of HHV-6 pathogenicity
still needs to be clarified, it has become clear that clinically serious
HHV-6 infections should benefit from specific antiviral therapy, as
pointed out in several reports (Cole et al., 1998
; Mookerjee & Vogelsang, 1997
).
In vitro, HHV-6 susceptibility to antiviral
compounds was found to be broadly similar to that of HCMV. HHV-6 is
sensitive to ganciclovir (GCV), a nucleoside analogue, cidofovir (CDV or
HPMPC), a nucleoside phosphonate analogue, and foscarnet (PFA), a
pyrophosphate analogue, which are the major antiviral agents used
currently to treat HCMV infections (Biron et al., 1985
; Crumpacker, 1996
; Freitas et al., 1985
). HHV-6 is relatively resistant to acyclovir (ACV). It is
known that suboptimal, long-term therapy of HCMV infection leads to the
emergence of drug-resistant HCMV. Numerous studies have shown that
nucleotide mutations in two genes, the DNA polymerase (pol) (UL54) gene
and the protein kinase (PK) (UL97) gene, are involved in this resistance
(Baldanti et al., 1996
; Chou et al., 1995
; Erice, 1999
; Lurain et al., 1994
; Sullivan et al., 1993
). Pol is the final target of the three major antiviral
agents and many of the mutations in the UL54 gene induce cross resistance
to two or three drugs. The biological role of PK, which is encoded by the
UL97 gene and which is also known as GCV kinase, is not understood
completely, but PK has been shown to convert GCV and ACV into their
monophosphate derivatives. Accordingly, mutations in the UL97 gene induce
GCV resistance, but the HCMV strains carrying these mutations remain
susceptible to HPMPC and PFA, unless they also carry UL54 gene
mutations.
HHV-6 infection has been found to be frequently
associated with HCMV infection and is probably underestimated in this
context as it is not generally the target of specific diagnostic
procedures. Therefore, it may be reasonably assumed that HHV-6 is exposed
to antiHCMV drugs in the context of therapies driven both by virological
HCMV markers and by clinical symptoms of the HCMV disease. This unrecognized exposure
to drugs is susceptible to significantly inhibit HHV-6
replication, but, alternatively, may lead to the selection of
drug-resistant HHV-6 strains. To date, there is no available data on HHV-6
resistance to GCV or on the possible molecular mechanisms that sustain
this process. As with HCMV, HHV-6 pol, which is encoded by the U38 gene,
is thought to be the common target of antiviral drugs. It has been shown
that HHV-6 PK, which is encoded by the U69 gene and is homologous to the
HCMV UL97 gene product, can phosphorylate GCV and confers GCV sensitivity
to baculovirus grown in insect cells expressing HHV-6 PK (Ansari &
Emery, 1999
). However, there continue to be
questions concerning the role of HHV-6 PK in HHV-6-infected human cells as
well as the existence of specific U69 gene mutations that induce GCV
resistance.
We decided to address these questions using two distinct approaches: (i) the selection and characterization of GCV-resistant HHV-6 isolates in vitro using prolonged exposure to GCV; and (ii) the characterization of HHV-6 isolates present in vivo in HCMV-infected patients treated with GCV for a long period of time. The results presented here converge to suggest that a U69 gene mutation induces the resistance of HHV-6 to GCV.
Methods |
Laboratory virus strains and cells. The
origin of the three HHV-6 variant A strains (SIE, TAN and U1102) and the
seven HHV-6 variant B strains (BLA, BLE, BOB, BOU, MAR, MBE and TRA)
studied have been described previously (Agut et al., 1988
, 1989
; Aubin et al., 1992
). These virus strains were propagated in PBMCs from
healthy donors as reported previously (Agut et al., 1989
). The HST strain, a HHV-6 variant B isolated
from a patient with exanthem subitum (Yamanishi et al., 1988), was
kindly provided by Koichi Yamanishi (Osaka University Medical School,
Osaka, Japan). The HST strain was adapted to grow in
the MT4 cell line, which is derived from a patient with adult T-cell
leukaemia and is human T-lymphotropic virus type I-transformed (Manichanh
et al., 2000
). These cells were
cultured in RPMI 1640 medium (Life Technologies) supplemented with 10 %
heat-inactivated foetal calf serum in the presence of 20 µg/ml
amikacin and vancomycin and 29.2 mg/ml L-glutamine.
HHV-6 infections were carried out at a concentration of 107
cells/ml and at an m.o.i. of 0.01 TCID50 per cell, starting
from virus stocks that had been preliminary titrated on the same cells by
end-point dilution assays.
Patient samples. Heparinized blood samples were obtained from 21 AIDS patients with HCMV disease. Each patient was followed up at the Pitié-Salpêtrière Hospital in Paris. The 21 patients were treated with GCV either alone or in combination with PFA and CDV. In addition, one blood sample was obtained from one healthy untreated HHV-6-seropositive volunteer. PBMCs were separated from whole blood by centrifugation on FicollHypaque (Pharmacia), washed with PBS and stored at 80 °C until use.
Antiviral agents and monoclonal antibody
(MAb). GCV, the nucleoside analogue
9-(1,3-dihydroxy-2-propoxymethyl)-guanine (Roche) was used for the
selection of GCV-resistant HHV-6 mutants and susceptibility assays. Two
other antiviral compounds, CDV/HPMPC,
(S)-1-(3-hydroxy-2-phosphonylmethoxypropyl)-cytosine, (Pharmacia
& Upjohn), and PFA (Astra), were evaluated for their activity against
HHV-6 wild-type (wt) virus and the GCV-resistant mutant. MAb 7C7 (Argene
Biosoft) was used for the detection of HHV-6 antigen expression by means
of immunofluorescence assays (IFA) and flow cytometry in the follow-up of
HHV-6 infection and susceptibility assays, respectively (Manichanh et
al., 2000
; Robert et al., 1998
).
Antiviral drug susceptibility assays. Drug
sensitivities were determined as described previously (Manichanh et
al., 2000
). Briefly, MT4 cells were infected
at an m.o.i. of 0.01 TCID50 per cell during 1 h of incubation
at 37 °C in the presence of 5 % CO2. Cells were recovered
by centrifugation, resuspended in culture medium and distributed at the
concentration of 2x105 cells per well in a 24-well plate
(Costar) in the presence of the appropriate concentrations of the drug.
Two wells containing infected cells and two containing mock-infected cells
without the drug were included as controls. At day 8 post-infection, virus
antigen expression was analysed by flow cytometry using MAb 7C7.
IC50 values were calculated as described previously (Manichanh
et al., 2000
).
DNA extraction. PBMCs or infected MT4 cells were resuspended in TE buffer (10 mM TrisHCl, pH 7.5, 1 mM EDTA, pH 8.0) containing 1 % SDS and 200 µg/ml proteinase K. After 2 h of incubation at 56 °C, total DNA was extracted with an equal volume of TE-saturated phenolchloroformisoamylalcohol (25:24:1). DNA was then precipitated with 2 vols of ethanol in the presence of 0.3 M sodium acetate and the pellet was washed in 70 % ethanol before resuspension in water. DNA extraction from ultracentrifuged culture supernatant was performed by resuspending the pellets in TE, incubating the mixture for 2 h at 56 °C followed by 10 min of incubation at 100 °C. The crude lysate was stored at 20 °C prior to DNA amplification.
PCR and nested-PCR for the amplification of HHV-6
DNA. PBMC DNA ranging from 100 ng to 1 µg was amplified during
40 cycles of PCR, each cycle consisting of denaturation at 92 °C for
1 min, primer annealing at 55 °C for 1 min and chain elongation with
polymerase at 72 °C for times dependent on the size of the DNA
fragment (1 min for 1000 bp). To improve the fidelity of DNA
amplification, we used a mixture of Pfu (Promega) and Taq
(Qiagen) polymerase at the ratio of 1:10. The U69 gene (1689 bp) from PBMC
samples was amplified using a two-step PCR: first-round PCR was carried
out using the primer pair GCVKA and GCVKB and second-round PCR consisted
of three separate overlapping nested-PCRs using the three primer pairs
GCVKA and GCVKB2, GCVKA1 and GCVKB1 and GCVKA2 and GCVKB, respectively (Table 1). Partial amplification of the U38 gene
from PBMCs was performed using the primer pair POLA-MOR and POLB-MOR. When
the starting DNA originated from HHV-6 propagated in cell culture, the
entire U38 gene as well as the entire U69 gene were amplified using
single-step PCR with the primer pairs POLA and POLB and GCVKA and GCVKB,
respectively (Table 1). Initial screening of HHV-6
DNA-positive PBMC samples as well as the follow-up of HHV-6 replication
in vitro was carried out with a routine PCR diagnostic assay using
the primer pair O10 and O15, as described previously (Collandre et
al., 1991
).
Table 1. Primers used to amplify and sequence HHV-6-specific products
The location of the primers refers to the nucleotide
sequence of HST strain (Isegawa et al., 1999
).
|
Primer |
Gene |
Sequence (5´ to 3´) |
Orientation |
Location |
Use |
|
GCVKA |
U69 |
CGACGAAATAATTGATACGGCAGC |
+ |
103776103799* |
PCR, sequencing |
|
GCVKA1 |
U69 |
ATGAAACTGTCGAATGCC |
+ |
105320105337 |
Sequencing |
|
GCVKA2 (HHV-6 variant A) |
U69 |
AGTCGTAACAAATTCTGTG |
+ |
104958104976* |
Sequencing |
|
GCVKA2 (HHV-6 variant B) |
U69 |
CAAATTCCGTTTGTATGGATC |
+ |
105768105789 |
Sequencing |
|
GCVKA3 |
U69 |
TGGTCAATGTATGCGAGGC |
+ |
106161106179 |
Sequencing |
|
GCVKB |
U69 |
CGGCCACAGAACTCAGTGTTTCAG |
|
105580105604* |
PCR, sequencing |
|
GCVKB1 (HHV-6 variant A) |
U69 |
CAACCTGGGCAAAAGCAC |
|
105091105108* |
Sequencing |
|
GCVKB1 (HHV-6 variant B) |
U69 |
CGACCTGAGCAAAGGC |
|
106230106246 |
Sequencing |
|
GCVKB2 |
U69 |
CCGAGAACTCGAGCCATAG |
|
105589105606 |
Sequencing |
|
POLA |
U38 |
TAGACAGGATCAGGTATAGAGG |
|
5961959640* |
PCR, sequencing |
|
POLABIS |
U38 |
CAGGTATAGAGGTTATAAGAG |
|
6055460574 |
Sequencing |
|
POLA1 |
U38 |
GATGTTAACCGGCGAGGTT |
|
6005560073 |
Sequencing |
|
POLA2 |
U38 |
GACGGCGTGCATATATATG |
|
5953459553 |
Sequencing |
|
POLA3 |
U38 |
GGGATAGGTTACAAAGGGGC |
|
5888258901 |
Sequencing |
|
POLA4 |
U38 |
GCATCTTTATGTCTGTCAG |
|
5829759317 |
Sequencing |
|
POLA5 |
U38 |
TGGAGTTTTCTCACATGACAC |
|
5879758818 |
Sequencing |
|
POLA-MOR |
U38 |
CAGACGCATAACTATGAATTAGC |
|
5770657728 |
PCR, sequencing |
|
POLB |
U38 |
CATGTACAAACGACAAAACCT |
+ |
5652156541* |
PCR, sequencing |
|
POLB1 |
U38 |
CGCAAGAAGTCTTTCTCACC |
+ |
5809158108 |
Sequencing |
|
POLB2 |
U38 |
CTATAACACAGATTATGCGCC |
+ |
5877758797 |
Sequencing |
|
POLB3 |
U38 |
GGTAAATCTTATCCATCC |
+ |
5939959416 |
Sequencing |
|
POLB4 |
U38 |
GTGTTGGCATTGTACCCATAC |
+ |
5998660006 |
Sequencing |
|
POLB-MOR |
U38 |
CATTACCTCTGCAATAGCAG |
+ |
5750757527 |
PCR, sequencing |
|
O10 |
U31 |
GATCCGACGCCTACAAACAC |
|
4623046249* |
PCR |
|
O15 |
U31 |
CGGTGTCACACAGCATGAACTCTC |
+ |
4541945442* |
PCR |
* Refers to the nucleotide sequence of the U1102
strain (Gompels et al., 1995
).
DNA Cloning. Cloning of the three overlapping U69 gene nested-PCR products obtained from PBMC samples was carried out using the TOPO TA Cloning kit (Invitrogen) with the pCR 2.1 vector, according to the manufacturer's instructions.
DNA sequencing and sequence analysis. PCR products and cloned U69 DNA fragments were sequenced with the Prism Big Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems). The corresponding primers used to sequence both the U69 and the U38 genes are described in Table 1. The average nucleotide sequence of each cloned U69 gene subfragment was established from the sequence of five to eight independent clones. The nucleotide and derived amino acid sequences were analysed using the following software: Sequencing Analysis, Sequence Navigator and AutoAssembler (Applied Biosystems).
Results |
Isolation of a GCV-resistant HHV-6 mutant
MT4 cells were infected with the HST strain of HHV-6 and incubated in the presence of GCV at the initial concentration of 8 µM. The development of HHV-6 infection was specifically monitored by testing aliquot fractions of the cell culture twice a week: IFA was performed on cultured cells and end-point dilution PCR was carried out on the supernatant in parallel. When a positive IFA signal was observed in more than 50 % of cells and/or a positive PCR signal was detected in the supernatant at a dilution of 104 or lower, the cell culture was divided into two equal fractions and naive (i.e. not yet exposed to either GCV or HHV-6) MT4 cells were added at the ratio 2:1. This serial co-culture propagation was designed in order to try to avoid any selection of MT4 cells exhibiting a putative higher resistance to GCV-induced cytotoxic effects. One resulting subculture was maintained at the same GCV concentration, while its counterpart was exposed to a 2-fold higher concentration of the drug. This procedure was repeated with every subsequent passage of the virus. When the replication of HHV-6 was not considered to be sufficient at a given concentration of GCV, additional passages were performed at the 2-fold lower concentration until the IFA and PCR end-points for HHV-6 replication were obtained. As controls, passages of HST in MT4 cells in the absence of GCV were performed in parallel to each step of selection under GCV pressure. After numerous serial passages over a period of 9 months, a reproducible efficient propagation of HHV-6 by co-culture was obtained in the presence of 128 µM GCV. The putative GCV-resistant mutant was purified twice by end-point dilution in the presence of this drug concentration using culture supernatant as a virus stock. A stock of purified virus with an infectious titre of 105 TCID50/ml was ultimately obtained, designated GCVR1 HST and submitted to further characterization.
Phenotypic analysis of GCVR1 HST
In the absence of GCV, GCVR1 HST exhibited replication dynamics similar to that of wt virus in terms of antigen expression and virus yield, as assessed by IFA and PCR, respectively (data not shown). GCVR1 HST was subsequently tested by flow cytometry-based susceptibility assay against three antiviral compounds, GCV, CDV and PFA. The results obtained from two independent experiments, each involving duplicate assays for each drug concentration, demonstrated a decrease in the sensitivity of GCVR1 HST to the three drugs tested as compared to wt virus (Table 2). Comparison of the IC50 values indicated that GCVR1 HST was 24-, 52- and 3-fold less sensitive to GCV, CDV and PFA, respectively, than wt HST. Although it had been selected in vitro under GCV pressure only, GCVR1 HST was cross-resistant to CDV and, to a much lower extent, PFA.
Table 2. Sensitivity of the wt HST and GCVR1 HST strains to antiviral compounds
The index of resistance is defined as the ratio of IC50 (µM) of GCVR1 HST to wt HST.
|
IC50 (µM)±SD |
|||
|
Compound |
wt HST |
GCVR1 HST |
Resistance Index |
|
GCV |
9±1 |
222±13.5 |
24 |
|
CDV |
6±0.65 |
315±65 |
52 |
|
PFA |
25±3.5 |
79±0.5 |
3 |
Genetic polymorphism of the U38 and U69 genes
The unexpected complex pattern of GCVR1 HST susceptibility to antiviral compounds raised the question of multiple mutations concerning both the pol and the PK genes. As a preliminary step, a consensus nucleotide sequence of these two genes was established, since this question had not been addressed previously. Three distinct strains of HHV-6 variant A and seven strains of HHV-6 variant B, which have never been exposed to GCV, were analysed in order to investigate the spontaneous genetic polymorphism of these two genes. Among the three HHV-6 variant A strains (SIE, U1102 and TAN) studied, the overall variability of the U38 gene was 1.08 %, (33 of 3039 nt); the deduced overall variability of the pol sequence was 0.45 %, (5 of 1013 aa). A consensus sequence was thus established for HHV-6 variant A pol (Fig. 1) from which SIE, U1102 and TAN pol diverged by 0.1, 0.9 and 0.03 %, respectively. Among the seven HHV-6 variant B strains (BLA, BLE, BOB, BOU, MAR, MBE and TRA) studied, the overall variability of the U38 gene was 0.46 % and that of pol was 0.3 % (3 of 1013 aa). A consensus pol sequence was defined for HHV-6 variant B strains (Fig. 1), which diverged by less than 0.2 % from individual HHV-6 variant B strain sequences and by 2.2 % from the consensus HHV-6 variant A sequence. A majority of intervariant diverging residues (19 of 22) were not involved in intravariant genetic polymorphism, pointing out the existence of variant-specific residues at particular positions of the pol sequence.
Fig. 1. Variability of the pol sequence among
HHV-6 strains. Nucleotide sequencing was carried out on DNA
amplified from HHV-6-infected cell cultures. The consensus HHV-6 variant A
sequence (HHV-6 A cs) was established from the pol sequences of SIE, U1102
and TAN strains. The consensus HHV-6 variant B sequence (HHV-6 B cs) was
established from the pol sequences of BLA, BLE, BOB, BOU, MAR, MBE and TRA
strains. Dashes indicate identical amino acid residues in HHV-6 A cs and
HHV-6 B cs. The open and closed circles correspond to the positions of amino acid residues that vary
between variants A and B, respectively. The arrow indicates the position of the amino acid residue
specifically modified in the case of GCVR1 HST.
A similar strategy of analysis was applied to the U69 gene, 1689 bp in length encoding HHV-6 PK (563 aa in the case of HHV-6 variant B) (Fig. 2). The overall nucleotide variability was 0.47 % among HHV-6 variant A strains and 0.11 % among HHV-6 variant B strains, leading to an amino acid variability of 0.71 % and 0.53 %, respectively, for the PK gene. The two consensus HHV-6 variant A and B PK sequences diverged by 5.7 %, while the divergence of each strain to the corresponding variant consensus sequence did not exceed 0.4 % and 0.2 % in the case of HHV-6 variant A and B strains, respectively. Of note, there is an insertion of one codon in the PK gene of HHV-6 variant B at position 75 as compared to the HHV-6 variant A PK gene. Again, the majority of intervariant diverging residues did not participate in intravariant variability.
Fig. 2. Variability of the PK sequence among
HHV-6 strains. Nucleotide sequencing was performed on DNA amplified from
HHV-6-infected cell cultures. The consensus HHV-6 variant A sequence
(HHV-6 A cs) was established from the PK sequences of SIE, U1102 and TAN
strains. The consensus HHV-6 variant B sequence (HHV-6 B cs) was
established from the PK sequences of BLA, BLE, BOB, BOU, MAR, MBE and TRA
strains. Dashes indicate identical amino acid residues in HHV-6 A cs and
HHV-6 B cs. The open and closed circles correspond to the positions of amino acid residues that vary
between variants A and B, respectively. The asterisk at position 75 of
HHV-6 A cs indicates the absence of an amino acid residue. The arrow indicates the position of the amino acid residue
specifically modified in the case of GCVR1 HST.
All together, these data demonstrated that HHV-6 pol and PK were highly conserved proteins, with a clear intervariant variability, founded on the existence of well-defined variant-specific polymorphism positions, but a low intravariant variability.
Genetic analysis of GCVR1 HST
The U38 and U69 genes of GCVR1 HST
were sequenced and compared to those of wt HST that had been serially
propagated in parallel to GCVR1 HST selection. Only two mutations were
detected (Figs 1 and 2). A C to T nucleotide substitution at position 2882 of the U38 gene resulted in an
A961V amino acid substitution in the pol gene.
An A to G nucleotide substitution at position 952 of the U69 gene resulted in an
M318V amino acid substitution in the PK gene. The sequences of
wt HST fit perfectly with the HHV-6 variant B consensus sequences and none
of the two mutations was located at any of the polymorphic sites detected
among distinct GCV-sensitive HHV-6 strains. The consensus sequences of
HHV-6 pol and PK were tentatively aligned with the homologous sequences of
HCMV (data not shown) in order to predict the possible influence of the
two mutations on enzyme function. The A961V mutation appeared
to be far distant from the predicted catalytic domains of pol (the nearest
putative catalytic domains of HHV-6 pol were domains VII and V at
positions 771 and 803, respectively) and did not fit the position of HCMV
mutations that had been involved in the resistance of HCMV to GCV (see
Discussion). In contrast, the M318V mutation was located within
the putative domain VI of HHV-6 variant B PK and affected the consensus
sequence D314ISPMN, which is homologous to the HCMV
D456ITPMN sequence. This sequence is believed to be a highly
conserved region among protein kinases and, in the case of HCMV, has been
shown to be the location of GCV-resistance mutations. Two distinct
GCV-resistant HCMV strains, R6HS (Lurain et al., 1994
) and C9209 (Chou et al., 1995
), have been found to exhibit M460I
and M460V amino acid substitutions in HCMV PK, respectively.
These changes were both responsible for the GCV resistance phenotype and
are homologous to the M318V change in HHV-6 PK. The results of
the genetic analysis of GCVR1 HST thus strongly suggested that the
M318V mutation of the HHV-6 PK was, at least in part,
responsible for the phenotypic GCV resistance observed. However, a role of
the A961V pol mutation for this phenotype, in the context of a
single mutation-induced cross resistance to GCV, CDV and PFA, might also
be considered.
In vivo genetic analysis of HHV-6 variant B among GCV-treated patients
In order to demonstrate unambiguously the causative role of the M318V PK mutation in GCV resistance, two distinct approaches, both of which were based on HHV-6 variant B replication in MT4 cells, were attempted: marker rescue experiments using the transfection of plasmids carrying the mutated gene and measurement of GCV phosphorylation rates with the hope of detecting a significant decrease of this activity in the presence of the mutation. To date, despite numerous attempts, both strategies have failed, in particular due to the difficulties of achieving a high multiplicity of infection and obtaining recombination events in MT4 cells (data not shown). We then turned to an alternative approach consisting of the study of the U69 gene among subjects exposed to GCV treatment for a long period of time and who were thought to suffer from a GCV-resistant HCMV infection. PBMC samples were obtained from 21 AIDS patients fulfilling these criteria and one untreated, healthy subject as a control. Five of the patients (24 %) and the control subject were found to be HHV-6 variant B-positive by means of diagnostic PCR (Table 3). Due to the low virus load, genetic study of the U69 gene from these subjects required separate amplification of three overlapping U69 subfragments and their cloning prior to nucleotide sequencing. One AIDS patient, designated patient #4, exhibited the M318V mutation of PK, while the other five patients and the control subject did not. These findings were reproducibly obtained from two independent amplification runs from the same sample. Partial sequencing of the HHV-6 variant B pol gene indicated that the A961V mutation was absent in the PBMC sample from patient #4. Of note is the fact that, at the time of PBMC sampling, patient #4 had experienced a long-term exposure to GCV and exhibited clinical symptoms of ongoing HCMV retinitis despite the prolonged GCV therapy. These circumstances suggest the selection of the M318V mutation in vivo, in parallel to prolonged inefficient GCV therapy. Isolation of the corresponding HHV-6 variant B strain from PBMC culture was not possible and, thus, did not permit us to test its susceptibility to GCV. A second sample from patient #4 was obtained a few weeks later. The patient was beginning to recover from retinitis and was found to be HHV-6-negative by PCR. Thus, we could not confirm the persistence of the M318V mutation.
Table 3. Characteristics of the studied HHV-6-positive subjects at the time of PBMC sampling
|
HCMV infection status |
Detection of specific HHV-6 mutation |
|||||||
|
Patient |
Sex |
Age (years) |
HIV infection status |
Viraemia |
Disease |
Ongoing GCV therapy |
A961V pol |
M318V PK |
|
#1 |
M |
22 |
AIDS |
+ |
|
+ |
ND |
|
|
#2 |
M |
46 |
AIDS |
+ |
|
+ |
ND |
|
|
#3 |
M |
46 |
AIDS |
+ |
Retinitis (recovery) |
+ |
ND |
|
|
#4 |
M |
42 |
AIDS |
+ |
Retinitis (ongoing) |
+ |
|
+ |
|
#5 |
M |
34 |
AIDS |
+ |
Retinitis (recovery) |
+ |
ND |
|
|
Control |
F |
33 |
No infection |
|
|
|
|
|
ND, Not determined due to the lack of sufficient PBMC DNA.
Discussion |
This is, to our knowledge, the first report of HHV-6 resistance to GCV. The mutant GCVR1 HST displays a decreased susceptibility to GCV, CDV and, to a lesser extent, PFA. This phenotypic pattern is associated with the M318V change of HHV-6 PK, which was also selected in vivo after prolonged inefficient GCV therapy. The definitive proof for the causative role of the M318V amino acid substitution in GCV resistance is still lacking. However, there is strong circumstantial evidence of this causative role based on the following arguments: (i) the corresponding U69 gene mutation has not been implicated as a marker of genetic polymorphism among GCV-sensitive HHV-6 strains; (ii) this mutation is homologous to the mutations of the UL97 gene implicated in the GCV resistance of HCMV; (iii) this mutation is located at a predicted crucial site of HHV-6 PK, which corresponds to a canonic motif present in other protein kinases; (iv) the data in vivo and in vitro converge to demonstrate the presence of this mutation as HHV-6 variant B is able to replicate under usually efficient GCV concentrations.
HHV-6 resistance to antiviral compounds is still an
emerging question. Although this virus has been found to be the cause of
severe opportunistic infections among immunocompromised patients, there
are, to date, only a few reports about the treatment of HHV-6 infection by
GCV, PFA and CDV, either alone or in combination (Cole et al.,
1998
; Mookerjee & Vogelsang, 1997
; Rieux et al., 1998
). However, it is clear, in particular from our results,
that HHV-6 is very often exposed to GCV in vivo through the
prophylaxis and treatment of HCMV infections. Our findings indicate that
this unrecognized exposure may select HHV-6 mutations distinct from the
usual polymorphism profile of the virus. These mutations, in particular
the reported M318V amino acid substitution, are likely to
confer a replication advantage to HHV-6 mutants under GCV pressure. Due to
the structural similarity of GCV and ACV, prolonged exposure to high
concentrations of ACV, as in the situation of HCMV infection prophylaxis,
might also be considered in terms of partial selective pressure against
both HCMV and HHV-6 PKs. Although the IC50 of ACV against both
viruses is high, we cannot rule out the hypothesis that partially
effective ACV concentrations may select PK changes, thus inducing a higher
resistance profile to GCV. It should be analysed to what extent this
unrecognized exposure of HHV-6 to antiherpetic compounds may induce the
emergence of drug resistance and compromise the success of further
treatments against this virus.
The mechanism of HHV-6 resistance to GCV remains to
be understood. The function of HHV-6 PK needs to be clarified in this
context. A role in the first step of GCV phosphorylation is strongly
suggested by the GCV-induced cytotoxic effect in insect cells expressing
HHV-6 PK (Ansari & Emery, 1999
). This mimics the effect observed with eukaryotic cells
expressing herpes simplex virus (HSV) thymidine kinase and which are
exposed to GCV, a well-known strategy for suicide gene therapy. The
mutation M318V is believed to alter the phosphorylation
activity of HHV-6 PK. This would consequently reduce the level of GCV
monophosphate within the cell, leading to the decrease of final
concentrations of GCV triphosphate active on HHV-6 pol. As mentioned
previously, the proof of this deficient phosphorylating activity cannot be
obtained under the current standard experimental conditions of HHV-6
infection and, therefore, requires other strategies.
However, another mechanism might be considered for
HHV-6 resistance to GCV. As in the case of HCMV, mutations of the pol gene
can induce GCV resistance, in particular by lowering the affinity of GCV
triphosphate to the binding site of the enzyme and/or reducing the
efficiency of the catalytic polymerization step involving this
triphosphate analogue. In this case, the GCV-resistance pol gene mutations
may also induce resistance to compounds that do not require the first step
of phosphorylation into the monophosphate moiety to be active, e.g. CDV
and PFA. GCVR1 HST does exhibit this pattern of cross resistance and, in
this context, the role of the single pol A961V change must be
discussed. This mutation is far distant from the predicted nucleotide
binding and catalytic sites of HHV-6 pol, namely domains IV, II, VI, III,
I and V located at positions 346, 551, 629, 662, 736 and 803, respectively
(Teo et al., 1991
). In particular, it is
far distant from the domains that are homologous to those carrying
GCV-resistance mutations in HCMV strains, domains IV and V (Lurain et
al., 1992
; Sullivan et al., 1993
). Nevertheless, any amino acid change may alter
the general conformation of the protein and, therefore, enzyme functions.
As an example, two mutations of the HSV pol gene located at the positions
1007 and 1028 of the amino acid sequence, i.e. beyond the last conserved
enzymatic domain, are able to induce resistance to HPMPA, a nucleotide
analogue closely related to CDV (Andrei et al., 2000
). However, in this case, the HPMPA-resistant
mutants were not resistant to either ACV or PFA, suggesting that the
mechanism of resistance was rather specific for HPMPA and did not affect
the sensitivity to either nucleoside or pyrophosphate analogues. It is,
therefore, tempting to assume that the A961V change of HHV-6
pol is responsible for its high resistance to CDV and moderate resistance
to PFA. Its contribution to GCV resistance cannot be completely ruled out,
in particular, because sequential processes may be considered for the
emergence of GCV resistance: the U69 mutations generating low level
resistance to the drug might be followed by the appearance of the U38
mutations inducing a higher level of resistance. This would be similar to
the sequential emergence of the UL97 and UL54 mutations observed with
GCV-resistant HCMV (Baldanti et al., 1996
). However, when a retrospective analysis was carried out
on the samples reserved from the serial intermediary passages under GCV,
no temporal dissociation was observed in the emergence of either mutation
in the GCV-resistant HHV-6 population. In any case, no mutation of HCMV
analogous to A961V has been reported for GCV-resistant viruses
and a unique role of A961V for the GCV-resistant phenotype,
excluding any contribution of the M318V PK change, is unlikely.
The question is why this mutation has been selected in vitro
without any use of CDV during HHV-6 propagation and not in vivo in
the HHV-6 variant B pol gene from patient #4. The GCV selection pressure
in vitro broadly differs from that exerted in vivo due to
the consistency of the drug concentration used, the monomorphic nature of
cells sustaining virus replication and the absence of many other
interfering factors specific for a human organism. In vitro, the
selection of GCV-resistant HHV-6, which, in our hands, resulted from a
long-standing procedure, may require some compensatory mutations in the
pol gene that, by chance, may induce CDV resistance. This illustrates the
fact, well known for other herpesviruses, that the isolation and
characterization of drug-resistant HHV-6 mutants may be helpful to
elucidate both the mechanisms of selective antiviral activity and the
dynamics of genetic evolution under selective pressure.
We thank François Bricaire and Christine Katlama for their help in the collection of PBMC samples, Koichi Yamanishi for kindly providing the HST strain of HHV-6 and Susan Orsoni for the critical reading of the manuscript. We are also grateful to Robert Snoeck, Lieve Naesens, Leen Debolle and Graciela Andrei for helpful discussions about herpesvirus resistance to antivirals. C.M. was sponsored by the Association Claude Bernard, Action Concertée Coordonnée des Sciences du Vivant, Association pour la Recherche sur le Cancer, MENRT (grant no. 98446).
References |
Crumpacker, C. S. (1996). Ganciclovir. New England Journal of Medicine 335, 721729.
Lusso, P. & Gallo, R. C. (1995). Human herpesvirus 6 in AIDS. Immunology Today 16, 6771.
© 2001 SGM
This article is now available in the November 2001 print issue of JGV (vol. 82, 27672776). The complete issue of the journal may be seen in electronic form on JGV Online.