| Journal of General Virology |
| SUMMARY | INTRO | METHODS | RESULTS | DISCUSSION | FOOTNOTES | REFS |
| First posted online 13 September 2001 | FULL-LENGTH ARTICLE |
| Rec 11 June 2001; Acc 31 August 2001 | DOI: 10.1099/vir.0.17915-0 |
Sonia Pina,1 Maria Buti,2 Rosend Jardí,3 Pilar Clemente-Casares,1 Joan Jofre1 and Rosina Girones1
1 Department of Microbiology,
University of Barcelona, Avd. Diagonal 645, 08028 Barcelona, Spain
2,3 Liver Unit2 and Department of
Biochemistry3, Hospital General Universitario Valle Hebron,
08035 Barcelona, Spain
The
Introduction |
Hepatitis A virus (HAV) has been classified as the
only member of the genus Hepatovirus within the family
Picornaviridae. As in other picornaviruses, the large open reading
frame present in the HAV genome may be divided into three functional
regions, termed P1, P2 and P3 (Rueckert & Wimmer, 1984
). The P1 genomic region encodes the capsid
polypeptides VP1, VP2, VP3 and VP4, and the P2 and P3 regions encode the
non-structural polypeptides necessary for virus replication. The lack of
antigenic diversity in HAV strains is related to a high degree of
conservation in the amino acid sequences of the capsid proteins (Ticehurst
et al., 1989
).
HAV is an enterically transmitted picornavirus that
causes acute hepatitis in humans and some primates. Transmission of the
virus by the faecaloral route results in the widespread endemic
asymptomatic infection of infants and children in developing countries.
Exposure of non-immune adolescent and adult populations within
industrialized regions of the world results in clinical disease. HAV has a
single antigenic serotype and a single infection is considered to confer
lifelong immunity (Gellis et al., 1945
; Lemon & Binn, 1983
; Neefe et al., 1964
; Rakela et al., 1976
). The limited antigenic variability of HAV has precluded
the use of serological approaches to differentiate precisely the sources
of HAV infection in various epidemiologically defined settings of endemic
and epidemic disease. Comparison of nucleotide sequences within a limited
region of the genome is an alternative approach to define the genetic
relatedness of different strains. Epidemiologically significant genomic
analysis requires the study of the wild-type virus to circumvent any
genetic changes associated with cell culture or animal adaptation. The use
of nested PCR amplification and partial sequencing described here to study
HAV strains detected in raw sewage, in other environmental samples and in
clinical samples provides a framework for improving molecular epidemiology
studies of HAV infection in a population.
Comparative studies of the nucleotide sequences of
different HAV strains have suggested that sequence relatedness can be
correlated with the geographical origin of the virus (Jansen et
al., 1990
; Robertson et al., 1991
). Analysis of sequence data derived from the
VP1/2A junction region allowed the description of seven distinct genotypes
of HAV (Robertson et al., 1992
).
Here, we depict HAV strains, identified in Barcelona (Spain), that have been recovered from both environmental water samples analysed over a 7 year period and clinical cases of acute hepatitis over a 5 year period. The study of these HAV strains will be useful for the design of improved strategies for the control of HAV infections.
Methods |
Water samples. A total of 54 raw
domestic sewage samples was collected from the sewage network of Barcelona
(Spain) from 1994 to 2000 (100 % positive for faecal coliforms, with a
mean concentration of 1.7x106 c.f.u./100 ml). Samples were
taken at the entry of a treatment plant receiving sewage from a population
of about 1.8 million people. Each sample was harvested in a sterile 500 ml
polyethylene container and kept at 4 °C for less than 8 h until the
virus particles were concentrated. The method applied for the recovery of
virus particles from sewage samples was chosen on the basis of previous
studies (Puig et al., 1994
; Pina et al., 1998
). Briefly, samples of 40 ml were ultracentrifuged at
229600 g for 1 h at 4 °C to sediment the virus
particles together with any suspended material. Viruses retained in the
sediment were eluted by mixing with 4 ml 0.25 M glycine
buffer (pH 9.5) on ice for 30 min. The suspended solids were then removed
by centrifugation at 12000 g for 15 min after the addition
of 4 ml 2x PBS. Viruses in the supernatant were pelleted by
ultracentrifugation at 229600 g for 1 h at 4 °C, resuspended
in 0.1 ml PBS and stored at 80 °
C.
Water samples (n=56) from the Llobregat
(50250 l depending on the turbidity,
103104 c.f.u./100 ml faecal coliforms) and Ter
(n=10) (250 l, <10 c.f.u./100 ml faecal coliforms) rivers were
collected from 1994 to 1998. The Llobregat and Ter rivers are located
south and north of Barcelona, respectively. Both rivers receive large
quantities of urban and industrial raw waste water, which contribute a
high level of chemical and faecal contamination. Samples were concentrated
primarily in situ using positively charged filters (Zeta-plus,
CUNO) (Sobsey & Jones, 1979
; Sobsey & Glass, 1980
). Filter cartridges were transported to the laboratory and
immersed in tryptone soy broth. The viruses retained were eluted with 1000
ml of 0.25 M glycine buffer (pH 9.510.5), concentrated by organic
flocculation with 3 % beef extract (pH 3.54.0) (Becton Dickinson) and recovered in 50
ml PBS (APHA, 1995
). Finally, virus particles were concentrated by
ultracentrifugation, according to the method described for the sewage
samples.
Human serum samples. Serum samples (n=74) from patients with acute hepatitis were randomly selected. Acute viral hepatitis was defined by the presence of specific clinical symptoms, which are as follows: serum alanine aminotransferase levels 10-fold higher than the normal upper values and exclusion of other causes of hepatocellular injury, including medications, alcohol, congestive heart failure, biliary disease, autoimmune hepatitis and other infections (e.g. cytomegalovirus and EpsteinBarr virus diseases). All serum samples were collected between October 1989 and December 2000 at the Hospital General Valle Hebron (located in Barcelona, Spain) from patients with symptoms of acute hepatitis. Samples were collected during the first month after the presentation of symptoms. Commercially available ELISA kits (Abbott) were used for the detection of IgM anti-HAV, HBV surface antigen, IgM anti-HBV, IgG anti-HEV and anti-HCV. HCV RNA was analysed by PCR (Amplicor HCV Monitor Test, version 2.0; Roche). Acute hepatitis A was diagnosed by the presence of IgM anti-HAV antibodies. Serum samples were stored at 80 °C until use for detecting genomic sequences.
Viruses. HAV strain pHM-175 was propagated in FRhK-4 cells growing in Eagle's minimal essential medium (MEM) (Auto-pow; ICN) containing 1.5 % sodium bicarbonate, 2 mM L-glutamine, non-essential amino acids, 100 U/ml penicillin, 100 µg/l streptomycin and 15 % foetal bovine serum. Virus suspensions were stored at 80 °C until use.
Nucleic acid extraction and enzymatic
amplification. Viral nucleic acid from serum samples or virus stocks
was extracted using guanidinium isothiocyanate, adsorbed onto silica
particles and eluted in elution buffer containing 10 mM TrisHCl (pH
8.0), 0.1 mM EDTA, 1 mM DTT and 0.24 U/µl ribonuclease inhibitor
(Boom et al., 1990
). RNA solutions were
diluted 1:10 in elution buffer.
For the detection of RNA genomes, 5 µl aliquots of the extracted nucleic acid (corresponding to 0.5 and 5 µl serum, 0.2 and 2 ml sewage or 1 and 5 l river water), 1.5 mM MgCl2 and 1x PCR buffer II (Perkin-Elmer), containing 10 mM TrisHCl (pH 8.3 at 25 °C), 50 mM KCl, 0.01 M DTT, 10 nmol of each dNTP and 25 pmol of the antisense primer (Table 1) in a total volume of 10 µl were used for reverse transcription. The reaction mixture was incubated at 95 °C for 5 min before the addition of 10 units of ribonuclease inhibitor (Applied Biosystems) and 50 units of reverse transcriptase from Moloney murine leukaemia virus (Applied Biosystems). After 30 min at 42 °C, the reaction was heated for 5 min at 95 °C.
Table 1. Oligonucleotide primers used for PCR amplification of HAV
The sequence position refers to the HM-175 strain of
HAV (Cohen et al., 1987 b
). For PCR, the melting temperature
(Tm) was calculated according to the equation
Tm=4x(number of pairs GC)+2x(number of pairs
AT).
|
Region |
Position |
Name |
Polarity |
Tm (°C) |
Product size (bp) |
Sequence (5´ to 3´) * |
|
5´ NTR |
332352 |
HAV1 |
Sense |
64 |
368 |
TTGGAACGTCACCTTGCAGTG |
|
680700 |
HAV2 |
Antisense |
64 |
CTGAGTACCTCAGAGGCAAAC |
||
|
371391 |
neHAV1 |
Sense |
58 |
290 |
ATCTCTTTGATCTTCCACAAG |
|
|
641661 |
neHAV2 |
Antisense |
64 |
GAACAGTCCAGCTGTCAATGG |
||
|
332351 |
HAV1d |
Sense |
62 |
376 |
TTGGRACGTCDCCTTGCAGT |
|
|
689708 |
HAV2d |
Antisense |
65 |
AAATGCCCCTGRGTACCTCAG |
||
|
644661 |
neHAV2d |
Antisense |
57 |
290 |
GWAMWGTCCAGCWDYHAATGG |
|
|
VP1/2A |
29062929 |
HHA1 |
Sense |
59 |
532 |
TGCAAATTAYAAYCAYTCTGATGA |
|
34163438 |
HHA2 |
Antisense |
61 |
TTTCTGTCCATTTYTCATCATTC |
||
|
29402960 |
HHA3 |
Sense |
48 |
436 |
TTYAGTTGYTAYTTGTCTGT |
|
|
33573376 |
HHA4 |
Antisense |
55 |
TCAAGAGTCCACACACTTC |
||
|
2B |
36273646 |
2B1 |
Sense |
58 |
343 |
GCAGATAGAATGCTTGGATT |
|
39513970 |
2B2 |
Antisense |
54 |
GAGTCCATYTGCCAATTAAA |
||
|
37503769 |
2B3 |
Sense |
59 |
220 |
TTTCAYCATTCTGTGACTG |
* R=A or G; D=G, A or T; W=A or T; Y=C or T; M=A or C; H=A, T or C.
For a typical one-step PCR, a 10 µl sample of cDNA was used. Amplification was carried out in a 50 µl reaction mixture containing 10 mM TrisHCl (pH 8.3 at 25 °C), 50 mM KCl, 1.5 mM MgCl2, 200 µM of each dNTP, 25 pmol of forward primer (Table 1) and 2 units of AmpliTaq DNA polymerase (Applied Biosystems). The amplification mixture was incubated in a GeneAmp 2400 PCR thermocycler (Applied Biosystems). The first cycle of denaturation was carried out for 3 min at 95 °C, followed by 30 cycles of denaturation at 95 °C for 60 s, annealing at 55 °C (for non-degenerate 5´ NTR primers), 42 °C (for degenerate VP1/2A primers) or 48 °C (for the primers of the 2B-region and the degenerate 5´ NTR primers) for 60 s and extension at 72 °C for 60 s. The final extension step was done at 72 °C for 5 min. Then, 1 µl (1/50) of the reaction mixture was added to a new batch of 50 µl PCR mixture, containing 25 pmol of each nested primer (Table 1) for a new PCR amplification cycle following the same procedure. PCR products were analysed by agarose gel electrophoresis using ethidium bromide as a stain.
To reduce the probability of sample contamination by amplified DNA molecules, standard precautions were applied in all manipulations. Separate areas were used for reagents, treatment of samples and manipulation of amplified samples. All samples were analysed twice in independent experiments and a negative control was added for each sample.
; Pina et al.,
2000
). Serial 10-fold dilutions of HAV
strain HM-175 RNA were tested by nested RTPCR. Sewage samples were
spiked with 2x103 genome equivalents per ml (GE/ml). One GE, as
determined by RTPCR, is defined as the number of genomes present in
the highest serial dilution shown to be positive by RTPCR. Virus
particles were recovered by the method described above. Serial 10-fold
dilutions of the RNA solution were reverse transcribed, amplified by the
two-step PCR procedure described above and the limits of detection were
then compared.
Sequencing and analysis of viral genomes. Nested
PCR products were purified using the QIAquick PCR Purification kit
(Qiagen). Both strands of purified DNA were sequenced with the ABI PRISM
BigDye Terminator Cycle Sequencing Ready Reaction kit with AmpliTaq
DNA polymerase (Applied Biosystems), according to the manufacturer's
instructions. Results were checked using the ABI PRISM 3700 automated
sequencer (Applied Biosystems). Sequences were then compared with the HAV
sequences present in GenBank and EMBL using the BLAST N program, version
2.0.8, and aligned with the corresponding sequence fragments of the
database using the CLUSTAL W program, version 1.8 (Thompson et al.,
1994
). Shading was carried out with the
GeneDoc program, version 2.5.000.
The transition/transversion parameter was estimated
from data sets using the PUZZLE program, version 4.0.2. Phylogenetic
distances were determined by the maximum-likelihood method using the
DNADIST program of the PHYLIP package, version 3.5c (Felsenstein, 1993
). Phylograms were generated by the UPGMA
algorithm using the NEIGHBOR program. The robustness of the grouping was
determined by bootstrap resampling of the multiple sequence alignments
(100 sets) with the programs SEQBOOT, DNADIST, NEIGHBOR and CONSENSE.
Bootstrap values greater than 70 % provide statistical evidence of
phylogenetic association (Felsenstein, 1985
). The output graphics of the trees were created with the
TREEVIEW package, version 1.5 (Page, 1996
).
Nucleotide sequence accession numbers. GenBank accession numbers of the HAV strain sequences characterized previously and used for phylogenetic studies are shown in Table 2. The sequences reported in this paper have been deposited into GenBank under the following accession numbers: AF386798AF386845 for the 5´ NTR sequences, AF386846AF386889 for the VP1/2A junction sequences and AF386890AF386911 for the 2B region sequences.
Table 2. HAV strains used for phylogenetic analysis
|
Strain |
Genotype |
GenBank accession no. |
Reference |
|
HM-175 |
IB |
M14707 |
|
|
HM-175/24a |
IB |
M59810 |
|
|
HM-175/43c |
IB |
M59809 |
|
|
HM-175/18f |
IB |
M59808 |
|
|
HM-175/7MK5 |
IB |
M16632 |
|
|
HAF-203 |
IB |
AF268396 |
Unpublished |
|
MBB |
IB |
M20273 |
|
|
L-A-1 |
IB |
AF314208 |
Unpublished |
|
LA |
IA |
K02990 |
|
|
HAS-15 |
IA |
X15464 |
|
|
GBM |
IA |
X75215 |
|
|
CR326 |
IA |
M10033 |
|
|
FG |
IA |
X83302 |
|
|
FH1 |
IA |
AB020567 |
Unpublished |
|
FH2 |
IA |
AB020568 |
Unpublished |
|
FH3 |
IA |
AB020569 |
Unpublished |
|
AH1 |
IA |
AB020564 |
Unpublished |
|
AH2 |
IA |
AB020565 |
Unpublished |
|
AH3 |
IA |
AB020566 |
Unpublished |
|
CF53 |
II |
M63025 |
|
|
PA21 |
IIIA |
M63026 |
|
|
Nor-24 |
IIIA |
AJ299467 |
|
|
Nor-20 |
IIIA |
AJ299463 |
|
|
CY145 |
IV |
M59286 |
|
|
AGM-27 |
V |
D00924 |
Results |
Sensitivity
RNA extracted from the HAV strain HM-175 stock was amplified
using primers specific for the 5´ NTR and VP1/2A region. Visible
bands (obtained after agarose gel electrophoresis) were evident up to a
106 dilution after nested PCR, which corresponds to 1 GE.
The estimated sensitivity for the detection of viral RNA in sewage samples
spiked with HAV strain HM-175 was shown to be 10 GE, which is equivalent
to the sensitivity of 110 virus particles, described previously when
sewage samples spiked with enterovirus were analysed (Puig et al.,
1994
; Pina et al., 1998
).
The sensitivity estimated for the detection of viral
RNA in serum was shown in previous studies to be of the same order as the
sensitivity observed for the virus stock when nested PCR amplification was
applied (Pina et al., 2000
); this demonstrated the absence of inhibitors of the
amplification reaction.
Presence of HAV in environmental samples
HAV RNA was detected in 31 of 54 raw sewage samples tested (57.4 %) after nested RTPCR using primers specific for the conserved 5´ NTR. RNA concentration was estimated by using a limiting dilution experiment and was found to range from 10 to 102 GE/ml. Samples with concentrations of RNA <10 GE/ml were deemed to be negative.
Of the 56 Llobregat river water samples, 22 (39.2 %) showed detectable levels of HAV, estimated to be between 10 and 102 GE/l. Viral RNA was also detected in 2 of 10 Ter river water samples tested (20 %) and the concentration was estimated to be 10 GE/l.
HAV in clinical samples
The diagnosis of acute HAV infection was confirmed by the presence of IgM anti-HAV in 26 of 74 serum samples taken from patients with acute hepatitis. Of the 26 patients, 16 (61.6 %) presented detectable levels of HAV RNA in the serum. These patients comprised 18 males and 8 females, with a mean age of 42 years (ranging from 24 to 79 years of age). Three patients were intravenous drug addicts and one had travelled to a developing country. Serum samples were obtained during the first week of symptoms in 10 cases, during the second week in 10 cases and between the third and the fourth week in six cases. All HAV RNA-positive samples were from patients whose serum was obtained between the first and the second week of presenting symptoms.
Sequence analysis of HAV RNA genomes
In order to characterize the
HAV strains detected in environmental and clinical samples, nested PCR
products from the 5´ NTR and the VP1/2A junction region were
sequenced. Sequence analysis of 248 nt of the 290 bp nested PCR amplicon
from the 5´ NTR of 33 environmental strains and 15 clinical strains
showed a high degree of identity, ranging from 90 to 100 % among samples
isolated between 1990 and 2000. Comparison of the nucleotide sequences
with that of the control strain, HM-175, showed 91.599.1 % identity
with the environmental strains and 90.798.4 % identity with the
clinical strains (Tables 3 and 4). Comparative analysis with
sequences from genetic databases indicated the presence of HAV variants
that were related closely to genotypes IB (HM-175, MBB and L-A-1) and IA
(GBM, LA, FG and FH), showing 94.7100 % identity with the
environmental samples and 97.5100 % identity with the serum samples.
Strains that cluster with strain PA21 (genotype IIIA) were identified in
two sewage samples and in one serum sample, with 9798 % identity
(Tables 3 and 4). Two A residues at positions 551 and 591 in the 5´
NTR fragment are characteristic of the wild-type HM-175 strain. These
nucleotides change to a G in cell culture-adapted strains after long-term
passage (Lemon et al., 1991
). All of the environmental and clinical strains detected
contain the A at positions 551 and 591, as described for wild-type viruses
(Lemon et al., 1991
).
Table 3. Sequence comparison of the conserved 5´ NTR region (248 nt) of HAV strains detected in environmental samples from 1994 to 2000
|
Comparison with the control strain |
Comparison with the identified strain |
||||
|
Sample* |
No. of identical nucleotides |
Identity (%) |
No. of identical nucleotides |
Identity (%) |
Strain |
|
Ll-05/09/94 |
246 |
99.1 |
248 |
100 |
HM-175, HAF-203 |
|
Ll-15/11/94 |
246 |
99.1 |
248 |
100 |
HM-175, HAF-203 |
|
SA-30/06/95 |
236 |
95.1 |
248 |
100 |
GBM, LA |
|
SA-28/07/95 |
235 |
94.7 |
247 |
99.6 |
GBM |
|
Ll-04/09/95 |
246 |
99.1 |
248 |
100 |
HM-175, HAF-203 |
|
Ll-18/12/95 |
246 |
99.1 |
248 |
100 |
HM-175, HAF-203 |
|
T-17/01/96 |
246 |
99.1 |
248 |
100 |
HM-175, HAF-203 |
|
Ll-24/02/97 |
244 |
98.3 |
246 |
99.1 |
MBB |
|
Ll-21/05/97 |
235 |
94.7 |
246 |
99.1 |
FH3 |
|
T-18/06/97 |
238 |
95.9 |
240 |
96.7 |
MBB |
|
Ll-06/08/97 |
246 |
99.1 |
248 |
100 |
HM-175, HAF-203 |
|
SA-07/10/97 |
238 |
95.9 |
245 |
98.7 |
FG |
|
SA-06/11/97 |
238 |
95.9 |
245 |
98.7 |
FG |
|
Ll-31/12/97 |
246 |
99.1 |
248 |
100 |
HM-175, HAF-203 |
|
SA-09/01/98 |
245 |
98.7 |
247 |
99.6 |
HM-175, HAF-203 |
|
SA-16/01/98 |
237 |
95.5 |
244 |
98.3 |
FG |
|
SA-23/01/98 |
238 |
95.9 |
245 |
98.7 |
FG |
|
SA-02/02/98 |
235 |
94.7 |
243 |
97.9 |
GBM, LA |
|
SA-11/02/98 |
237 |
95.5 |
244 |
98.3 |
FG |
|
Ll-25/02/98 |
243 |
97.9 |
247 |
99.5 |
MBB |
|
SA-22/03/99 |
244 |
98.3 |
246 |
99.1 |
MBB |
|
SA-26/03/99 |
241 |
97.1 |
243 |
97.9 |
GBM, LA |
|
SA-09/06/00 |
242 |
97.6 |
246 |
99.1 |
MBB |
|
SA-23/06/00 |
242 |
97.6 |
238 |
95.9 |
GBM, LA |
|
SA-11/07/00 |
235 |
94.7 |
235 |
94.7 |
L-A-1 |
|
SA-03/08/00 |
235 |
94.7 |
241 |
97.1 |
GBM, LA |
|
SA-16/08/00 |
244 |
98.3 |
238 |
95.9 |
GBM, LA |
|
SA-01/09/00 |
236 |
95.1 |
242 |
97.5 |
GBM, LA |
|
SA-05/10/00 |
234 |
94.4 |
246 |
99.1 |
GBM, LA |
|
SA-26/10/00 |
244 |
98.3 |
228 |
91.9 |
PA21 |
|
SA-06/11/00 |
244 |
98.3 |
246 |
99.1 |
HM-175, MBB |
|
SA-04/12/00 |
227 |
91.5 |
243 |
98.3 |
PA21 |
|
SA-29/12/00 |
236 |
95.1 |
248 |
100 |
GBM, LA |
* SA-dd/mm/yy, sewage sample; Ll-dd/mm/yy, Llobregat river water sample, T-dd/mm/yy, Ter river water sample.
Data correspond to the strain identified according to hypervariable region analysis.
Table 4. Sequence comparison of the conserved 5´ NTR region (248 nt) of HAV strains detected in serum samples from 1990 to 2000
|
Comparison with the control strain |
Comparison with the identified strain |
||||
|
Sample |
No. of identical nucleotides |
Identity (%) |
No. of identical nucleotides |
Identity (%) |
Strain |
|
HS-05/03/90 |
238 |
96.0 |
244 |
98.4 |
GBM, LA |
|
HS-10/11/90 |
234 |
94.4 |
247 |
99.5 |
MBB |
|
HS-17/01/91 |
237 |
95.6 |
243 |
97.9 |
GBM, LA |
|
HS-27/02/91 |
243 |
98.0 |
247 |
99.5 |
MBB |
|
HS-26/08/91 |
242 |
97.6 |
246 |
99.1 |
MBB |
|
HS-17/09/91 |
236 |
95.2 |
248 |
100 |
GBM, LA |
|
HS-25/09/91 |
241 |
97.2 |
245 |
98.7 |
MBB |
|
HS-20/05/92 |
234 |
94.4 |
246 |
99.1 |
GBM, LA |
|
HS-08/09/92 |
232 |
93.6 |
242 |
97.5 |
GBM, LA |
|
HS-07/10/92 |
243 |
98.0 |
247 |
99.5 |
MBB |
|
HS-06/04/99 |
244 |
98.4 |
246 |
99.1 |
HM-175, MBB |
|
HS-27/04/00 |
233 |
93.9 |
245 |
98.7 |
GBM, LA |
|
HS-16/10/00 |
234 |
94.4 |
246 |
99.1 |
GBM, LA |
|
HS-13/11/00 |
225 |
90.7 |
242 |
98.3 |
PA21 |
|
HS-21/11/00 |
243 |
97.9 |
247 |
99.5 |
MBB |
The VP1/2A junction region is recognized as one of
the most variable regions of the HAV genome (Robertson et al.,
1992
) and was therefore chosen for
genotyping and phylogenetic analysis. The sequence of 398 nt of the 436 bp
nested PCR product from the VP1/2A region was determined for 27 strains
detected in environmental water samples and in 16 clinical samples.
Sequence comparison among the environmental and clinical samples showed
76100 % identity and 76.899.2 % identity with the control
strain, respectively. Comparative analysis with other isolates described
previously confirms the presence of HAV strains belonging to genotypes IA
and IB, with 93.7100 % identity. Two of the sewage samples and two
serum samples collected from October to December 2000 (SA-26/10/00,
HS-13/11/00, SA-04/12/00 and HS-14/12/00) showed the presence of HAV
strains related closely to strains PA21 and Nor-24 (genotype IIIA), with
more than 99 % identity. The phylogenetic tree based on the alignment of
the VP1/2A fragment is shown in Fig. 1.
Fig. 1. Phylogram depicting the relationship
between the environmental and clinical HAV strains in relation to other
isolates characterized previously over a 296 bp fragment of the VP1/2A
junction region. Scale represents genetic distance. The internal node
numbers represent bootstrap values (100 replicates) expressed as the
percentage of all trees. Values greater than 70 % indicate statistically
significant grouping (Felsenstein, 1985
).
Point mutations were observed in the nucleotide
sequence of the VP1/2A region of the environmental and clinical strains
that differ from the control strain. The C at position 3018 of the control
strain is changed to a T in all of the environmental and clinical strains.
Moreover, all clinical isolates showed additional substitutions: the C at
position 3002 in the HM-175 control strain is changed to a T in all
strains detected in serum samples, the T at position 3248 is changed to an
A, the G at position 3281 is changed to an A or a C, the G at position
3287 is changed to an A and the A at position 3353 is changed to a T.
These mutations demonstrate the presence of wild-type strains in
environmental water and clinical samples. Within the 2A region, the
mutations described at positions 3248 and 3281 result in the substitution
of the lysine and isoleucine residues at positions 47 and 58 to asparagine
and methionine residues, respectively: these mutations are related to
adaptation to cell culture growth (Lemon et al., 1991
).
The results showed a similar prevalence of strains identified as genotypes IA and IB (55 and 40 %, respectively) in the environmental samples and 43.7 % of each subgenotype in serum samples. The strains related closely to genotype IIIA were identified in two environmental samples (5 %) and in two clinical samples (12.5 %).
We sequenced 182 nt of a 220 bp fragment within the
2B region in some of the environmental and clinical HAV strains. A
mutation at position 3889 (C changed to a U), which has been described in
cell culture-adapted strains, is responsible for an alanine to a valine
substitution at amino acid position 72 of the 2B protein (Cohen et
al., 1987 a
; Emerson et
al., 1993
). All strain sequences showed a C
in that position (data not shown), as described for wild-type strains,
which eliminates the possibility of cross-contamination with laboratory
strains.
Discussion |
The study presented here provides a framework for global analysis of the HAV strains that circulate among the population in Barcelona and includes a description of the most prevalent HAV strains present in the environment and also those strains that resulted in cases of acute viral hepatitis. Results based on virus concentration from raw sewage or other environmental water samples, nested RTPCR amplification and partial sequencing yields reliable information on the molecular epidemiology of HAV infection in an area located in the north-eastern region of Spain.
Sequence analysis of the environmental and clinical
samples showed a high prevalence of genotype I strains. Genotype I
comprise 80 % of HAV strains isolated worldwide, as described by Robertson
et al. (1992
). Genomic analysis shows
that more than one HAV genotype could be identified within the same year
in the same location; over a period of a few years, the most prevalent
strains may differ. Genotypes IA and IB were found in the clinical samples
collected from 1990 to 1992 at a proportion of 50 % each.
Genotype IB strains, related closely to strains HM-175, MBB and L-A-1, were identified in the environment throughout the period from 1994 to 2000. Genotype IA strains were also abundant and identified as GBM variants in 52.5 % of the isolates. LA- and HAS-15-related strains were the most prevalent during the year 2000 (in 5 of up to 12 isolates), together with MBB- and L-A-1-like strains (in 3 of up to 12 samples). Genotype IIIA variants were also detected in two samples.
A good concordance was observed between the strains
detected in the environment and in clinical serum samples collected from
patients with acute hepatitis during the year 2000, with genotypes IA, IB
and IIIA circulating in the environment and among hepatitis patients.
However, 100 % nucleotide identity in closely related strains detected in
the clinical and environmental strains was never observed. This fact
indicates that a high number of strains is currently circulating in the
population, since it is accepted that, during infection, no sequence
differences are usually detected, even between different patients involved
in the same outbreak (Robertson et al., 1992
).
Genotype III strains were detected in the
environment and in hepatitis patients during the same period of time. This
genotype has been demonstrated to be highly prevalent among intravenous
drug users in Northern Europe (Robertson et al., 1992
; Stene-Johansen et al., 1999
). This is in agreement with the fact that one
of the patients that presented a virus strain similar to strain Nor-24
belonged to that group, although in the second patient, no specific risk
factor was identified.
HAV infection is considered to be endemic in the
Mediterranean region and, as has been described previously in other
countries, is characterized in Spain by diminishing HAV seroprevalence in
the population (Papaevangelou, 1992
; Dal-Ré et al., 2000
; Lopalco et al., 2001
). Within the specific area studied (Catalonia, Spain), a
seroprevalence of 67.8 % in the general population has been documented;
less than 5 % of a group of patients who were between 5 and 14 years of
age were seropositive (Bruguera et al., 1999
). Therefore, a large percentage of the Spanish population
under 30 years of age is not protected against hepatitis. The results
presented here show the circulation of several HAV strains identical to,
or closely related to, strains isolated previously in highly divergent
geographical areas worldwide. In this study, 79 HAV-positive samples
collected over a period of 10 years were analysed. It was not possible to
identify strains belonging to a common endemic genotype, as proposed by
Robertson et al. (1992
), suggesting the circulation of endemic strains in the USA
between 1976 and 1990. Two hypotheses may explain this fact: (i) the
higher frequency of travelling in the area and (ii) the higher prevalence
of the infection in an endemic area, together with the fact that HAV has a
high level of stability in the environment (Sobsey et al., 1988
). During the year 2000, although the number of
cases of hepatitis A has been estimated to be less than 1530 per
100000 habitants, 80 % of urban sewage samples studied showed the presence
of HAV. Since faecal shedding of HAV can, in some cases, last for months
after the resolution of symptoms (Yotsuyanagi et al., 1996
), such
patients could be a source of further virus spreading within the
community. It is important that this factor is considered as a possible
reason for the abundance of HAV observed in the environment. Moreover, low
levels of HAV multiplication in the intestinal epithelial cells has been
suggested (Blank et al., 2000
). This could represent a mechanism of virus amplification.
Further monitoring will be needed to evaluate if there is a reduction in
the presence of HAV in the environment over the next few years. Due to the
low prevalence of antibodies in the young and the simultaneous abundance
of HAV circulating in the environment, it may be important to consider the
availability of a HAV vaccine in areas where sanitary is poor.
This work was partially supported by the research grants SGR/00023 from the Catalan Government and FIS 00/1123 from the 'Ministerio de Sanidad y Consumo' from the Spanish Government. Sonia Pina was in receipt of a fellowship from the Catalan Government. The authors thank the staff of the Servicios Científico-Técnicos of the University of Barcelona for their help in the sequencing of the PCR products. We also thank Drs S. U. Emerson and R. H. Purcell of the National Institutes of Health (NIAID, NIH, Bethesda, MD, USA) for their useful advice.
References |
© 2001 SGM
This article is now available in the December 2001 print issue of JGV (vol. 82, 29552963). The complete issue of the journal may be seen in electronic form on JGV Online.